Skip to main content

pLNCX2-NGN2-IRES-GFP-T2A-Sox11
(Plasmid #90213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90213 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLNCX2
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NGN2-IRES-GFP-T2A-Sox11
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Entrez Gene
    Sox11 (a.k.a. 1110038H03Rik, 6230403H02Rik, AI836553, end, end1)
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer acctacaggtggggtctttcattccc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLNCX2-NGN2-IRES-GFP-T2A-Sox11 was a gift from Chun-Li Zhang (Addgene plasmid # 90213 ; http://n2t.net/addgene:90213 ; RRID:Addgene_90213)
  • For your References section:

    Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic neurons. Liu ML, Zang T, Zou Y, Chang JC, Gibson JR, Huber KM, Zhang CL. Nat Commun. 2013;4:2183. doi: 10.1038/ncomms3183. 10.1038/ncomms3183 PubMed 23873306