pLO99
(Plasmid
#90219)
-
PurposeComplements mutations in Aspergillus nidulans gene lysB (AN5206) (mutants require lysine)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR-BluntII Topo
-
Backbone manufacturerInvitrogen
-
Vector typeAspergillus
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATET_03691
-
SpeciesAspergillus terreus NIH 2624
- Promoter pLac
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer SP6 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert sequence contains flanking sequences not from the Aspergillus terreus genome that were added to facilitate cloning. These sequences are caatgctcttcaccctcttc and agtgcctcctctcagacag. For more information, please see the attached supplemental file.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLO99 was a gift from Berl Oakley (Addgene plasmid # 90219 ; http://n2t.net/addgene:90219 ; RRID:Addgene_90219) -
For your References section:
New multi-marker strains and complementing genes for Aspergillus nidulans molecular biology. Dohn JW Jr, Grubbs AW, Oakley CE, Oakley BR. Fungal Genet Biol. 2018 Feb;111:1-6. doi: 10.1016/j.fgb.2018.01.003. Epub 2018 Jan 5. 10.1016/j.fgb.2018.01.003 PubMed 29309843