Skip to main content

pLO99
(Plasmid #90219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR-BluntII Topo
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Aspergillus

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATET_03691
  • Species
    Aspergillus terreus NIH 2624
  • Promoter pLac

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert sequence contains flanking sequences not from the Aspergillus terreus genome that were added to facilitate cloning. These sequences are caatgctcttcaccctcttc and agtgcctcctctcagacag. For more information, please see the attached supplemental file.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLO99 was a gift from Berl Oakley (Addgene plasmid # 90219 ; http://n2t.net/addgene:90219 ; RRID:Addgene_90219)
  • For your References section:

    New multi-marker strains and complementing genes for Aspergillus nidulans molecular biology. Dohn JW Jr, Grubbs AW, Oakley CE, Oakley BR. Fungal Genet Biol. 2018 Feb;111:1-6. doi: 10.1016/j.fgb.2018.01.003. Epub 2018 Jan 5. 10.1016/j.fgb.2018.01.003 PubMed 29309843
Commonly requested with: