Skip to main content
Addgene

pCW003
(Plasmid #90226)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90226 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-4T1
  • Backbone manufacturer
    GE
  • Backbone size w/o insert (bp) 4969
  • Total vector size (bp) 5044
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ST-1a
  • Alt name
    ST-P
  • Species
    Escherichia coli ETEC H10407
  • Insert Size (bp)
    78
  • Mutation
    GATCCCCGGGTACCGAGCTCG encoding DPRVPSS linker prior to start of mature enterotoxin peptide
  • GenBank ID
    YP_003294006.1
  • Promoter Ptac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid when expressed in E. coli will produce a fusion protein of GST and the ST-P (ST1a) heat stable toxin. It is not likely that the toxin will be secreted under these conditions. It will likely only have biological activity when purified, and the ST-P peptide fragment is liberated by thrombin cleavage.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW003 was a gift from James Fleckenstein (Addgene plasmid # 90226)
  • For your References section:

    Molecular determinants of enterotoxigenic Escherichia coli heat-stable toxin secretion and delivery. Zhu Y, Luo Q, Davis SM, Westra C, Vickers TJ, Fleckenstein JM. Infect Immun. 2018 Aug 20. pii: IAI.00526-18. doi: 10.1128/IAI.00526-18. 10.1128/IAI.00526-18 PubMed 30126899