1068 pGL3 FasL promoter (no SV40 prom)
(Plasmid
#9029)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 9029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3 promoter
- Backbone size w/o insert (bp) 4810
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFas ligand promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)100
-
MutationRemoved the SV40 promoter from pGL3
-
Entrez GeneFASLG (a.k.a. ALPS1B, APT1LG1, APTL, CD178, CD95-L, CD95L, FASL, TNFSF6, TNLG1A)
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer RVprimer3
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Oligonucleotides 5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTATTTAAATAAATAAGTAAATAAATAAAC-3' and 5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were phosphorylated, annealed, and ligated to pGL3-promoter restricted with BglII and NheI to give pGL3-promoter-FasL. This plasmid was subsequently restricted with BglII and HindIII, blunted, and ligated to remove the simian virus 40
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1068 pGL3 FasL promoter (no SV40 prom) was a gift from William Sellers (Addgene plasmid # 9029 ; http://n2t.net/addgene:9029 ; RRID:Addgene_9029) -
For your References section:
Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers WR. Mol Cell Biol. 2000 Dec . 20(23):8969-82. 10.1128/MCB.20.23.8969-8982.2000 PubMed 11073996
Map uploaded by the depositor.