Skip to main content

pM9_NR_HD
(Plasmid #90415)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90415 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPha-NR
  • Backbone manufacturer
    GenBank_NCBI: JN180663
  • Backbone size w/o insert (bp) 3860
  • Total vector size (bp) 7011
  • Modifications to backbone
    Site directed mutagenesis of BsaI Restriction sites, to delete it. Zeocin resistance gene (Sh ble) from the pPha-NR vector was exchanged with the Nourseothricin resistance gene (nat).
  • Vector type
    Phaeodactylum tricornutum
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN Backbone
  • Species
    Phaeodactylum tricornutum

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCAGTTGCTGAAGATCGCGAAGC
  • 3′ sequencing primer TGCCACTCGATGTGATGTCCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Tale Toolbox Feng Zhang, from Addgene. kit #1000000019
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

N.E. Sanjana, L. Cong, Y. Zhou, M.M. Cunniff, G. Feng, F. Zhang
A transcription activator-like effector toolbox for genome engineering
Nat. Protoc., 7 (2012), pp. 171–192

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM9_NR_HD was a gift from Peter Kroth (Addgene plasmid # 90415 ; http://n2t.net/addgene:90415 ; RRID:Addgene_90415)
  • For your References section:

    A fast and reliable strategy to generate TALEN-mediated gene knockouts in the diatom Phaeodactylum tricornutum. Serif M, Lepetit B, Weissert K, Kroth PG, Rio Bartulos C. Algal Research Volume 23, April 2017, Pages 186–195 10.1016/j.algal.2017.02.005