Skip to main content

pSAM_AraC
(Plasmid #91569)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91569 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSAM_Ec
  • Backbone manufacturer
    N/A
  • Backbone size w/o insert (bp) 4559
  • Total vector size (bp) 5906
  • Modifications to backbone
    Put arabinose inducible promoter before transposase
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    S17-1λpir
  • Growth instructions
    Add 10 mM glucose to repress transposase. S17-1λpir may be EndA+ so extra purification steps may be necessary during miniprep.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AraC/PBAD
  • Species
    E. coli
  • Insert Size (bp)
    1200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site NcoI (unknown if destroyed)
  • 5′ sequencing primer TTATGACAACTTGACGGCTA
  • 3′ sequencing primer ATGCCATAGCATTTTTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mariner himar1C9 transposase driven by an arabinose promoter on an R6K gamma suicide plasmid. The transposon allows identification of fitness factors by Illumina sequencing. This transposon will randomly insert a kanamycin resistance cassette into genomic TA sites. Ampicillin resistance is contained on the plasmid backbone.

For further background, see:
Goodman, Andrew L., Meng Wu, and Jeffrey I. Gordon. “Identifying Microbial Fitness Determinants by Insertion Sequencing (INSeq) Using Genome-Wide Transposon Mutant Libraries.” Nature Protocols 6.12 (2011): 1969–1980. PMC. Web. 11 Apr. 2017.

Wiles, Travis J. et al. “Combining Quantitative Genetic Footprinting and Trait Enrichment Analysis to Identify Fitness Determinants of a Bacterial Pathogen.” Ed. Danielle A. Garsin. PLoS Genetics 9.8 (2013): e1003716. PMC. Web. 11 Apr. 2017.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSAM_AraC was a gift from Harry Mobley (Addgene plasmid # 91569 ; http://n2t.net/addgene:91569 ; RRID:Addgene_91569)
  • For your References section:

    Genome-wide transposon mutagenesis of Proteus mirabilis: Essential genes, fitness factors for catheter-associated urinary tract infection, and the impact of polymicrobial infection on fitness requirements. Armbruster CE, Forsyth-DeOrnellas V, Johnson AO, Smith SN, Zhao L, Wu W, Mobley HLT. PLoS Pathog. 2017 Jun 14;13(6):e1006434. doi: 10.1371/journal.ppat.1006434. PPATHOGENS-D-17-00798 [pii] PubMed 28614382