-
PurposeCas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX459
- Backbone size w/o insert (bp) 2522
- Total vector size (bp) 8866
-
Modifications to backboneRemoval of F1 promoter. Exchange of 2A-puro with 2A-miRFP670.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namehSpCas9-2A-miRFP670
-
Alt nameCas9
-
Alt nameiRFP
-
SpeciesSynthetic
-
Insert Size (bp)6300
-
GenBank IDhSpCas9-2A-miRFP670
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- 2A-miRFP670 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTTATGGCGAGGCGGCGG
- 3′ sequencing primer CATCACTAGGGGTTCCTGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBB-guide RNA
-
Alt nameU6-BB-gRNA
-
SpeciesSynthetic
-
Insert Size (bp)300
-
GenBank IDU6- BbsI-gRNA
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GACAGGTATCCGGTAAGCGG
- 3′ sequencing primer TGGAAAGTCCCTATTGGCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFrom Addgene #62988 and #79987
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is an altered version of the Zhang Lab's Addgene Plasmid #62988 Cas9-2A-Puro. The miRFP670 came from Verkhusha Lab's Addgene Plasmid #79987. The 2A sequence from the original plasmid was kept. Also, the F1 sequence was deleted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-miRFP670 was a gift from Ralf Kuehn (Addgene plasmid # 91854 ; http://n2t.net/addgene:91854 ; RRID:Addgene_91854)