Skip to main content

pBabe-Tet-off-uniRapR-mCherry-Vav2(DPZ)
(Plasmid #91874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBABE
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rapamycin-activatable Vav2;DPZ: DH-PH-ZnF domains of Vav2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1020
  • Entrez Gene
    VAV2 (a.k.a. VAV-2)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
  • 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe-Tet-off-uniRapR-mCherry-Vav2(DPZ) was a gift from Klaus Hahn (Addgene plasmid # 91874 ; http://n2t.net/addgene:91874 ; RRID:Addgene_91874)
  • For your References section:

    Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211