-
PurposeDoxycycline inducible expression of mouse REST
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIX_403
-
Backbone manufacturerDavid Root lab
- Backbone size w/o insert (bp) 9396
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameREST
-
Alt nameNRSF
-
Alt nameRE1-Silencing Transcription Factor
-
Alt nameNeuron-Restrictive Silencer Factor
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3660
-
GenBank IDNM_011263
-
Entrez GeneRest (a.k.a. 2610008J04Rik, NRSF, REST4)
- Promoter TRE promoter, Tet ON
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byREST/NRSF insert DNA obtained from Addgene 21310, pHR'-NRSF-CITE-GFP
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIX-REST was a gift from Julien Sage (Addgene plasmid # 91896 ; http://n2t.net/addgene:91896 ; RRID:Addgene_91896)