pACYC_HA-ZmSAE1_ZmSAE2(TRUNC)-FLAG
(Plasmid
#91945)
-
PurposeBacterial expression of maize SAE1 and truncated SAE2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACYCDuet-1
- Backbone size w/o insert (bp) 4008
- Total vector size (bp) 6558
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHA-ZmSAE1
-
SpeciesZea mays
-
Insert Size (bp)1035
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZmSAE2-FLAG
-
SpeciesZea mays
-
Insert Size (bp)1515
-
MutationTruncation of ZmSAE2 to mimic a splice variant
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer TGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC_HA-ZmSAE1_ZmSAE2(TRUNC)-FLAG was a gift from Richard Vierstra (Addgene plasmid # 91945 ; http://n2t.net/addgene:91945 ; RRID:Addgene_91945) -
For your References section:
Defining the SUMO System in Maize: SUMOylation Is Up-Regulated during Endosperm Development and Rapidly Induced by Stress. Augustine RC, York SL, Rytz TC, Vierstra RD. Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15. 10.1104/pp.16.00353 PubMed 27208252