Skip to main content

lentiCRISPRv2.sgNf1.4
(Plasmid #92029)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92029 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPRv2 Cas9-FLAG-2A-Puro
  • Total vector size (bp) 13006
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgNf1.4 for Nf1 deletion
  • gRNA/shRNA sequence
    GATTATCCGAATTCTTAGCA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NC_000077

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPRv2.sgNf1.4 was a gift from Wen Xue (Addgene plasmid # 92029 ; http://n2t.net/addgene:92029 ; RRID:Addgene_92029)
  • For your References section:

    Genome-Wide CRISPR Screen Identifies Regulators of Mitogen-Activated Protein Kinase as Suppressors of Liver Tumors in Mice. Song CQ, Li Y, Mou H, Moore J, Park A, Pomyen Y, Hough S, Kennedy Z, Fischer A, Yin H, Anderson DG, Conte D Jr, Zender L, Wang XW, Thorgeirsson S, Weng Z, Xue W. Gastroenterology. 2017 Apr;152(5):1161-1173.e1. doi: 10.1053/j.gastro.2016.12.002. Epub 2016 Dec 10. 10.1053/j.gastro.2016.12.002 PubMed 27956228