lentiCRISPRv2.sgNf1.4
(Plasmid
#92029)
-
PurposesgNf1.4 for Nf1 deletion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPRv2 Cas9-FLAG-2A-Puro
- Total vector size (bp) 13006
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgNf1.4 for Nf1 deletion
-
gRNA/shRNA sequenceGATTATCCGAATTCTTAGCA
-
SpeciesM. musculus (mouse)
-
GenBank IDNC_000077
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPRv2.sgNf1.4 was a gift from Wen Xue (Addgene plasmid # 92029 ; http://n2t.net/addgene:92029 ; RRID:Addgene_92029) -
For your References section:
Genome-Wide CRISPR Screen Identifies Regulators of Mitogen-Activated Protein Kinase as Suppressors of Liver Tumors in Mice. Song CQ, Li Y, Mou H, Moore J, Park A, Pomyen Y, Hough S, Kennedy Z, Fischer A, Yin H, Anderson DG, Conte D Jr, Zender L, Wang XW, Thorgeirsson S, Weng Z, Xue W. Gastroenterology. 2017 Apr;152(5):1161-1173.e1. doi: 10.1053/j.gastro.2016.12.002. Epub 2016 Dec 10. 10.1053/j.gastro.2016.12.002 PubMed 27956228