BPTF PHD and Bromodomain
(Plasmid
#92101)
-
PurposeExpresses GST fusion PHD and Bromodomain from BPTF protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-6P-2
- Backbone size w/o insert (bp) 4985
- Total vector size (bp) 5501
-
Vector typeBacterial Expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21 Codon plus strain should be used for expression
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePHD and Bromodomain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)507
-
GenBank IDGI 31322942
-
Entrez GeneBPTF (a.k.a. FAC1, FALZ, NEDDFL, NURF301)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- GST Tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BPTF PHD and Bromodomain was a gift from Albert Jeltsch (Addgene plasmid # 92101 ; http://n2t.net/addgene:92101 ; RRID:Addgene_92101)