Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BPTF PHD and Bromodomain
(Plasmid #92101)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92101 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-6P-2
  • Backbone size w/o insert (bp) 4985
  • Total vector size (bp) 5501
  • Vector type
    Bacterial Expression
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21 Codon plus strain should be used for expression
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PHD and Bromodomain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    507
  • GenBank ID
    GI 31322942
  • Entrez Gene
    BPTF (a.k.a. FAC1, FALZ, NEDDFL, NURF301)
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST Tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BPTF PHD and Bromodomain was a gift from Albert Jeltsch (Addgene plasmid # 92101 ; http://n2t.net/addgene:92101 ; RRID:Addgene_92101)