pDIS3
(Plasmid
#92173)
-
PurposeVector containing the two fragments comprising the 550 bp NEUT5L region with NAT1 marker. Integration by disruption of the region targeted for recombination.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS314
- Total vector size (bp) 6599
-
Vector typeYeast Expression ; GenBank: U03440.1
-
Selectable markersNAT1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNAT1
-
SpeciesCandida albicans
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site sacI (unknown if destroyed)
- 3′ cloning site SacII (unknown if destroyed)
- 5′ sequencing primer GTGCCGTAAAGCACTAAATCGG
- 3′ sequencing primer GTTACCTCACTCATTAGGCACCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDIS3 was a gift from Judith Berman (Addgene plasmid # 92173 ; http://n2t.net/addgene:92173 ; RRID:Addgene_92173) -
For your References section:
Shuttle vectors for facile gap repair cloning and integration into a neutral locus in Candida albicans. Gerami-Nejad M, Zacchi LF, McClellan M, Matter K, Berman J. Microbiology. 2013 Mar;159(Pt 3):565-79. doi: 10.1099/mic.0.064097-0. Epub 2013 Jan 10. 10.1099/mic.0.064097-0 PubMed 23306673