Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #92173)


Item Catalog # Description Quantity Price (USD)
Plasmid 92173 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 6599
  • Vector type
    Yeast Expression ; GenBank: U03440.1
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Candida albicans

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site sacI (unknown if destroyed)
  • 3′ cloning site SacII (unknown if destroyed)
  • 5′ sequencing primer GTGCCGTAAAGCACTAAATCGG
  • 3′ sequencing primer GTTACCTCACTCATTAGGCACCCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDIS3 was a gift from Judith Berman (Addgene plasmid # 92173 ; ; RRID:Addgene_92173)
  • For your References section:

    Shuttle vectors for facile gap repair cloning and integration into a neutral locus in Candida albicans. Gerami-Nejad M, Zacchi LF, McClellan M, Matter K, Berman J. Microbiology. 2013 Mar;159(Pt 3):565-79. doi: 10.1099/mic.0.064097-0. Epub 2013 Jan 10. 10.1099/mic.0.064097-0 PubMed 23306673