-
PurposeLentiviral overexpression vector to make stable bicistronic cell line for Tau screen
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-GPS-GAW-IRES
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 11415
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDsRed-IRES-MAPT-EGFP
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)3368
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer IRES-F: GCCCCCCGAACCACGGGGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-DsRed_IRES_MAPT:EGFP was a gift from Huda Zoghbi (Addgene plasmid # 92196 ; http://n2t.net/addgene:92196 ; RRID:Addgene_92196) -
For your References section:
TRIM28 regulates the nuclear accumulation and toxicity of both alpha-synuclein and tau. Rousseaux MW, de Haro M, Lasagna-Reeves CA, De Maio A, Park J, Jafar-Nejad P, Al-Ramahi I, Sharma A, See L, Lu N, Vilanova-Velez L, Klisch TJ, Westbrook TF, Troncoso JC, Botas J, Zoghbi HY. Elife. 2016 Oct 25;5. pii: e19809. doi: 10.7554/eLife.19809. 10.7554/eLife.19809 PubMed 27779468