Skip to main content
Addgene
Open Menu

pJOP-HTT-HR30Q
(Plasmid #92247)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92247 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 92247-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 92247-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    PBHR100A-1 (SBI)
  • Backbone size w/o insert (bp) 7925
  • Vector type
    PrecisionX HR targeting vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HTT donor DNA
  • Species
    H. sapiens (human)
  • Mutation
    Barcode of wobble bases to prevent TALEN cleaving donor DNA: CAC CTA CCC CAA CCG CC
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI/NotI (not destroyed)
  • 3′ cloning site BspQI (destroyed)/SpeI (destroyed during cloning)
  • 5′ sequencing primer GTTTCGCCACCTCTGACTTG (-588)
  • 3′ sequencing primer TCATTTTGACTCACGCGGTC (-196)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJOP-HTT-HR30Q was a gift from Mahmoud Pouladi (Addgene plasmid # 92247 ; http://n2t.net/addgene:92247 ; RRID:Addgene_92247)

  • For your References section:

    Unbiased Profiling of Isogenic Huntington Disease hPSC-Derived CNS and Peripheral Cells Reveals Strong Cell-Type Specificity of CAG Length Effects. Ooi J, Langley SR, Xu X, Utami KH, Sim B, Huang Y, Harmston NP, Tay YL, Ziaei A, Zeng R, Low D, Aminkeng F, Sobota RM, Ginhoux F, Petretto E, Pouladi MA. Cell Rep. 2019 Feb 26;26(9):2494-2508.e7. doi: 10.1016/j.celrep.2019.02.008. 10.1016/j.celrep.2019.02.008 PubMed 30811996
Related items:
Commonly requested with: