pJOP-HTT-HR81Q
(Plasmid #92250)

• Purpose: HTT donor DNA with 81Q for homologous recombination-mediated gene modification
• Depositing Lab: Mahmoud Pouladi
• Publication: Ooi et al Cell Rep. 2019 Feb 26;26(9):2494-2508.e7. doi: 10.1016/j.celrep.2019.02.008.

Backbone

• Vector backbone: PBHR100A-1 (SBI)
• Backbone size w/o insert (bp): 7925
• Vector type: PrecisionX HR targeting vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HTT donor DNA
• Species: H. sapiens (human)
• Mutation: Barcode of wobble bases to prevent TALEN cleaving donor DNA: CAC CTG CCC CAC CCG CC
• Entrez Gene: HTT (a.k.a. HD, IT15, LOMARS)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI/NotI (not destroyed)
• 3′ cloning site: BspQI (destroyed)/SpeI (destroyed during cloning)
• 5′ sequencing primer: GTTTCGCCACCTCTGACTTG (-588)
• 3′ sequencing primer: TCATTTTGACTCACGCGGTC (-196)

Resource Information

• Supplemental Documents:
  • pJOP-HTT-HR81Q.gb
• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry