Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pZac2.1 hSynapsin1 NAPA-N SV40
(Plasmid #92282)


Item Catalog # Description Quantity Price (USD)
Plasmid 92282 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Neuron-astrocyte proximity assay - Neuronal
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter hSynapsin1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACCATCTGCGCTGCGGCG
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 hSynapsin1 NAPA-N SV40 was a gift from Baljit Khakh (Addgene plasmid # 92282 ; ; RRID:Addgene_92282)
  • For your References section:

    An Optical Neuron-Astrocyte Proximity Assay at Synaptic Distance Scales. Octeau JC, Chai H, Jiang R, Bonanno SL, Martin KC, Khakh BS. Neuron. 2018 Apr 4;98(1):49-66.e9. doi: 10.1016/j.neuron.2018.03.003. 10.1016/j.neuron.2018.03.003 PubMed 29621490