Skip to main content

pZac2.1 hSynapsin1 NAPA-N SV40
(Plasmid #92282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92282 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pZac2.1
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neuron-astrocyte proximity assay - Neuronal
  • Alt name
    NAPA-N
  • Species
    Synthetic
  • Insert Size (bp)
    1653
  • Promoter hSynapsin1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACCATCTGCGCTGCGGCG
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATCAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 hSynapsin1 NAPA-N SV40 was a gift from Baljit Khakh (Addgene plasmid # 92282 ; http://n2t.net/addgene:92282 ; RRID:Addgene_92282)
  • For your References section:

    An Optical Neuron-Astrocyte Proximity Assay at Synaptic Distance Scales. Octeau JC, Chai H, Jiang R, Bonanno SL, Martin KC, Khakh BS. Neuron. 2018 Apr 4;98(1):49-66.e9. doi: 10.1016/j.neuron.2018.03.003. 10.1016/j.neuron.2018.03.003 PubMed 29621490