Skip to main content

pJL006
(Plasmid #92329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92329 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCA24N
  • Backbone manufacturer
    NBRP-E.coli at NIG
  • Backbone size w/o insert (bp) 4500
  • Modifications to backbone
    replaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For fluorescence studies, grow at RT or 30C. Note the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FtsZ
  • Species
    E. coli
  • Insert Size (bp)
    1149
  • Mutation
    D212A
  • Promoter T5-lac
  • Tag / Fusion Protein
    • mEos3.2 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctttcgtcttcacctcgagaaatc
  • 3′ sequencing primer gctaattaagcttggctgcaggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL006 was a gift from Jie Xiao (Addgene plasmid # 92329 ; http://n2t.net/addgene:92329 ; RRID:Addgene_92329)
  • For your References section:

    Influence of FtsZ GTPase activity and concentration on nanoscale Z-ring structure in vivo revealed by three-dimensional Superresolution imaging. Lyu Z, Coltharp C, Yang X, Xiao J. Biopolymers. 2016 Oct;105(10):725-34. doi: 10.1002/bip.22895. 10.1002/bip.22895 PubMed 27310678
Commonly requested with: