pJL006
(Plasmid
#92329)
-
PurposeExpress mEos3.2 tagged FtsZD212A mutant in E coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCA24N
-
Backbone manufacturerNBRP-E.coli at NIG
- Backbone size w/o insert (bp) 4500
-
Modifications to backbonereplaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor fluorescence studies, grow at RT or 30C. Note the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)1149
-
MutationD212A
- Promoter T5-lac
-
Tag
/ Fusion Protein
- mEos3.2 (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctttcgtcttcacctcgagaaatc
- 3′ sequencing primer gctaattaagcttggctgcaggt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL006 was a gift from Jie Xiao (Addgene plasmid # 92329 ; http://n2t.net/addgene:92329 ; RRID:Addgene_92329) -
For your References section:
Influence of FtsZ GTPase activity and concentration on nanoscale Z-ring structure in vivo revealed by three-dimensional Superresolution imaging. Lyu Z, Coltharp C, Yang X, Xiao J. Biopolymers. 2016 Oct;105(10):725-34. doi: 10.1002/bip.22895. 10.1002/bip.22895 PubMed 27310678