-
PurposeCAG-driven ubiquitous expression of Cas9. Contains 2A-Citrine reporter. For CRISPR mediated gene knockouts in chicken embryos.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4944
- Total vector size (bp) 9886
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 2A Citrine
-
Insert Size (bp)4944
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTAACCATGTTCATGCCTTC
- 3′ sequencing primer CTGAGGAGTGAATTGCGGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCas9_2A_Citrine was amplified from pTK Cas9_2A_Citrine (Williams et al 2017) and inserted into pCI_H2B_RFP (Betancur 2010) digested with Not1 and Nhe1 to remove IRES_H2B_RFP
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Betancur, P., M. Bronner-Fraser, and T. Sauka-Spengler. 2010. Genomic code for Sox10 activation reveals a key regulatory enhancer for cranial neural crest. Proc Natl Acad Sci U S A. 107:3570-3575.
Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG Cas9-2A-Citrine was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92358 ; http://n2t.net/addgene:92358 ; RRID:Addgene_92358) -
For your References section:
Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245