PhOTO-C (pMTB:cyto-Dendra2-2A-H2B-Cerulean)
(Plasmid
#92402)
-
PurposeConstitutive expression of cytosolic green-to-red photoconvertible Dendra2 and the nuclear blue fluorescent protein Cerulean.
-
Depositing Lab
-
Depositing OrganizationETH Zurich (Swiss Federal Institute of Technology)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 92402-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 92402-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMTB
- Backbone size w/o insert (bp) 6103
- Total vector size (bp) 8241
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDendra2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDGU734658.1
- Promoter bactin2
-
Tag
/ Fusion Protein
- No tag, cytosolic expression
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer SP6- atttaggtgacactatagaagag
- 3′ sequencing primer ccttagtcaccgccttcttg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCerulean
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDKP666136.1
- Promoter bactin2
-
Tag
/ Fusion Protein
- H2B tag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer caggaGAGGGCAGAGGAA
- 3′ sequencing primer CCGCTGAGCAATAACTAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 92402-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 92402-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PhOTO-C (pMTB:cyto-Dendra2-2A-H2B-Cerulean) was a gift from Periklis Pantazis (Addgene plasmid # 92402 ; http://n2t.net/addgene:92402 ; RRID:Addgene_92402) -
For your References section:
PhOTO zebrafish and primed conversion: advancing the mechanistic view of development and disease. Kalyviotis K, Qin H, Pantazis P. (2020) Behavioral and Neural Genetics of Zebrafish, 309–322. 10.1016/B978-0-12-817528-6.00019-X