Skip to main content

mEGFP-PI35P2
(Plasmid #92419)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92419 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    CloneTech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCOLN1
  • Alt name
    Mouse MCOLN1 residues 1–68; Mucolipin 1, phosphoinositide binding domain.
  • Species
    M. musculus (mouse)
  • Mutation
    Synthetic gene, codon optimized for human.
  • GenBank ID
    NM_053177.1 NM_053177.1
  • Entrez Gene
    Mcoln1 (a.k.a. 2210015I05Rik, TRPML1, mucolipidin)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCCGCCGGGATCAC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mEGFP-PI35P2 was a gift from Geert van den Bogaart (Addgene plasmid # 92419 ; http://n2t.net/addgene:92419 ; RRID:Addgene_92419)
  • For your References section:

    SWAP70 is a universal GEF-like adapter for tethering actin to phagosomes. Baranov MV, Revelo NH, Verboogen DRJ, Ter Beest M, van den Bogaart G. Small GTPases. 2017 May 10:0. doi: 10.1080/21541248.2017.1328302. 10.1080/21541248.2017.1328302 PubMed 28489960