Skip to main content
Addgene
Open Menu

mEGFP-PI35P2
(Plasmid #92419)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92419 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 92419-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 92419-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    CloneTech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCOLN1
  • Alt name
    Mouse MCOLN1 residues 1–68; Mucolipin 1, phosphoinositide binding domain.
  • Species
    M. musculus (mouse)
  • Mutation
    Synthetic gene, codon optimized for human.
  • GenBank ID
    NM_053177.1 NM_053177.1
  • Entrez Gene
    Mcoln1 (a.k.a. 2210015I05Rik, TRPML1, mucolipidin)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCCGCCGGGATCAC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mEGFP-PI35P2 was a gift from Geert van den Bogaart (Addgene plasmid # 92419 ; http://n2t.net/addgene:92419 ; RRID:Addgene_92419)

  • For your References section:

    SWAP70 is a universal GEF-like adapter for tethering actin to phagosomes. Baranov MV, Revelo NH, Verboogen DRJ, Ter Beest M, van den Bogaart G. Small GTPases. 2017 May 10:0. doi: 10.1080/21541248.2017.1328302. 10.1080/21541248.2017.1328302 PubMed 28489960
Related items:
Commonly requested with: