FRB_T2098L-VAMP3-mCherry
(Plasmid #92429)

• Purpose: Expression of VAMP3 N-terminally conjugated to FRB and C-terminally conjugated to mCitrine.
• Depositing Lab: Geert van den Bogaart
• Publication: Verboogen et al Elife. 2017 May 19;6. pii: e23525. doi: 10.7554/eLife.23525.

Backbone

• Vector backbone: pmCherry-N1
• Backbone manufacturer: CloneTech
• Modifications to backbone: none
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VAMP3
• Alt name: VAMP3, cellubrevin
• Species: M. musculus (mouse)
• GenBank ID: NP_033524.1
• Entrez Gene: Vamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
• Promoter: CMV
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • FKBP rapamycin binding (FRB) domain of mTOR with mutation T2098L; allows for heterodimerization with FKBP by rapamycin analogue. (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAACAACTCCGCCCCATT
• 3′ sequencing primer: CACCTTGAAGCGCATGAACT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry