Skip to main content
Addgene

FlagETR3 (CELF2)
(Plasmid #96900)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 96900 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1 HisC
  • Backbone size w/o insert (bp) 5456
  • Total vector size (bp) 6958
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human CELF2 cDNA
  • Alt name
    ETR3
  • Alt name
    CUGBP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1502
  • Entrez Gene
    CELF2 (a.k.a. BRUNOL3, CELF-2, CUG-BP2, CUGBP2, DEE97, ETR-3, ETR3, NAPOR)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATA
  • 3′ sequencing primer CAGAATAGAATGACACCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FlagETR3 (CELF2) was a gift from Thomas Cooper (Addgene plasmid # 96900 ; http://n2t.net/addgene:96900 ; RRID:Addgene_96900)
  • For your References section:

    A bichromatic fluorescent reporter for cell-based screens of alternative splicing. Orengo JP, Bundman D, Cooper TA. Nucleic Acids Res. 2006;34(22):e148. Epub 2006 Nov 16. 10.1093/nar/gkl967 PubMed 17142220