-
Purposeexpression of Flag-tagged human CELF2 (aka CUGBP2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1 HisC
- Backbone size w/o insert (bp) 5456
- Total vector size (bp) 6958
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman CELF2 cDNA
-
Alt nameETR3
-
Alt nameCUGBP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1502
-
Entrez GeneCELF2 (a.k.a. BRUNOL3, CELF-2, CUG-BP2, CUGBP2, DEE97, ETR-3, ETR3, NAPOR)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATA
- 3′ sequencing primer CAGAATAGAATGACACCTAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FlagETR3 (CELF2) was a gift from Thomas Cooper (Addgene plasmid # 96900 ; http://n2t.net/addgene:96900 ; RRID:Addgene_96900) -
For your References section:
A bichromatic fluorescent reporter for cell-based screens of alternative splicing. Orengo JP, Bundman D, Cooper TA. Nucleic Acids Res. 2006;34(22):e148. Epub 2006 Nov 16. 10.1093/nar/gkl967 PubMed 17142220