pTH846-gst-dissc
(Plasmid
#96907)
-
PurposePlasmid for yeast expression of GST encoded by non-preferred codons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 96907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBEVY-U
-
Backbone manufacturerC. A. I. Miller, M. A. Martinat, and L. E. Hyman (1998) Nucleic Acids Res., vol. 26, no. 15, pp. 3577–3583.
- Backbone size w/o insert (bp) 6534
- Total vector size (bp) 7242
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyeast codon dis-optimised glutathione-S transferase
-
Speciessynthetic construct
-
Insert Size (bp)694
-
GenBank IDLT856600.1
- Promoter TDH3
-
Tag
/ Fusion Protein
- 8xhistidine (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ctaataagtatataaagaacggtagg
- 3′ sequencing primer tggaaaagggtcaaatcgttggta (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTH846-gst-dissc was a gift from Tobias von der Haar (Addgene plasmid # 96907 ; http://n2t.net/addgene:96907 ; RRID:Addgene_96907) -
For your References section:
Codon-Dependent Translational Accuracy Controls Protein Quality in Escherichia coli but not in Saccharomyces cerevisiae. Jossé L, Sampson CDD, Tuite MF, Howland K, von der Haar T. bioRxiv 200006 10.1101/200006