371-T
(Plasmid
#97035)
-
Purpose(Empty Backbone) His6-Thioredoxin-tev-yORF
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size (bp) 5143
-
Vector typeBacterial Expression
- Promoter T7
-
Tags
/ Fusion Proteins
- His6 tag (N terminal on backbone)
- Thioredoxin funsion (N terminal on backbone)
- TEV cleavage site (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer Thioredoxin F (5' tatggcatccgtggtatcc 3')
- 3′ sequencing primer T7 Reverse
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV cleavable His6-Thioredoxin fusion tag on the N-terminus
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/.
In the 371-Series plasmids, upstream of each ribosome binding site is a Csy4 target sequence that allows the polycistronic mRNA to be cleaved upstream of each message when your plasmid is co-expressed with the Csy4 protein. By cleaving the message we hope to avoid detrimental mRNA structures that may result from having a long polycistronic message.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
371-T was a gift from Chris Jeans (Addgene plasmid # 97035 ; http://n2t.net/addgene:97035 ; RRID:Addgene_97035)