Skip to main content

pCMV-PTEN-3'UTR
(Plasmid #97204)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97204 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-MCS
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7836
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTEN 3' UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3393
  • GenBank ID
    U93051
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, PTENgama, TEP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV Forward or B-globin Forward, ATTCTGAGTCCAAGCTAGGC
  • 3′ sequencing primer hGH polyA Reverse, TAGAAGGACACCTAGTCAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pCMV-PTEN-3'UTR was created by sub-cloning partial fragments of PTEN 3'UTR from HeLa gDNA using Gibson Assembly. The cloned insert was confirmed by DNA sequencing.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-PTEN-3'UTR was a gift from Reproducibility Project Cancer Biology (Addgene plasmid # 97204 ; http://n2t.net/addgene:97204 ; RRID:Addgene_97204)
  • For your References section:

    Replication Study: A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. Kerwin J, Khan I, Iorns E, Tsui R, Denis A, Perfito N, Errington TM. Elife. 2020 Apr 21;9. pii: 51019. doi: 10.7554/eLife.51019. 10.7554/eLife.51019 PubMed 32314732