pCMV-PTEN-3'UTR
(Plasmid
#97204)
-
PurposeExpresses PTEN 3'UTR in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-MCS
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 7836
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEN 3' UTR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3393
-
GenBank IDU93051
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
- Promoter CMV
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward or B-globin Forward, ATTCTGAGTCCAAGCTAGGC
- 3′ sequencing primer hGH polyA Reverse, TAGAAGGACACCTAGTCAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCMV-PTEN-3'UTR was created by sub-cloning partial fragments of PTEN 3'UTR from HeLa gDNA using Gibson Assembly. The cloned insert was confirmed by DNA sequencing.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-PTEN-3'UTR was a gift from Reproducibility Project Cancer Biology (Addgene plasmid # 97204 ; http://n2t.net/addgene:97204 ; RRID:Addgene_97204) -
For your References section:
Replication Study: A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. Kerwin J, Khan I, Iorns E, Tsui R, Denis A, Perfito N, Errington TM. Elife. 2020 Apr 21;9. pii: 51019. doi: 10.7554/eLife.51019. 10.7554/eLife.51019 PubMed 32314732