Skip to main content

K84M kinase-dead Nuak1-3xflag
(Plasmid #97219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    3xflag-CMV plasmid
  • Backbone manufacturer
    Sigma-Aldrich
  • Backbone size w/o insert (bp) 6299
  • Total vector size (bp) 8299
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Nuak1
  • Alt name
    ARK5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Mutation
    Kinase-dead K84M
  • Entrez Gene
    NUAK1 (a.k.a. ARK5)
  • Promoter T7
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CTGGAAAATATACTGCTCGA
  • 3′ sequencing primer GGTCAGGATGCAGTGCCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    http://dharmacon.gelifesciences.com/cdnas-and-orfs/mammalian-orfs/orfeome-collaboration/orfeome-collaboration-clones/?productId=B197C4CE-93C2-421F-AB6C-FB92D52CB839&sourceId=entrezgene/9891&term=BC160165 Modified with a kinase-dead K84M mutation

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K84M kinase-dead Nuak1-3xflag was a gift from Huda Zoghbi (Addgene plasmid # 97219 ; http://n2t.net/addgene:97219 ; RRID:Addgene_97219)
  • For your References section:

    Reduction of Nuak1 Decreases Tau and Reverses Phenotypes in a Tauopathy Mouse Model. Lasagna-Reeves CA, de Haro M, Hao S, Park J, Rousseaux MW, Al-Ramahi I, Jafar-Nejad P, Vilanova-Velez L, See L, De Maio A, Nitschke L, Wu Z, Troncoso JC, Westbrook TF, Tang J, Botas J, Zoghbi HY. Neuron. 2016 Oct 19;92(2):407-418. doi: 10.1016/j.neuron.2016.09.022. Epub 2016 Oct 6. 10.1016/j.neuron.2016.09.022 PubMed 27720485