K84M kinase-dead Nuak1-3xflag
(Plasmid #97219)

• Purpose: Plasmid expressing kinase-dead mutant Nuak1
• Depositing Lab: Huda Zoghbi
• Publication: Lasagna-Reeves et al Neuron. 2016 Oct 19;92(2):407-418. doi: 10.1016/j.neuron.2016.09.022. Epub 2016 Oct 6.

Backbone

• Vector backbone: 3xflag-CMV plasmid
• Backbone manufacturer: Sigma-Aldrich
• Backbone size w/o insert (bp): 6299
• Total vector size (bp): 8299
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Nuak1
• Alt name: ARK5
• Species: H. sapiens (human)
• Insert Size (bp): 2000
• Mutation: Kinase-dead K84M
• Entrez Gene: NUAK1 (a.k.a. ARK5)
• Promoter: T7
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CTGGAAAATATACTGCTCGA
• 3′ sequencing primer: GGTCAGGATGCAGTGCCTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: http://dharmacon.gelifesciences.com/cdnas-and-orfs/mammalian-orfs/orfeome-collaboration/orfeome-collaboration-clones/?productId=B197C4CE-93C2-421F-AB6C-FB92D52CB839&sourceId=entrezgene/9891&term=BC160165 Modified with a kinase-dead K84M mutation

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry