Skip to main content
Addgene
Open Menu

pAMPATPro35SS:3xHA-At bZIP63CC
(Plasmid #97284)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97284 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAMPATPro35SS:3xHA-GW
  • Backbone manufacturer
    Singh et al., 2014
  • Backbone size w/o insert (bp) 5481
  • Total vector size (bp) 5931
  • Modifications to backbone
    modified by Singh et al., 2014 from pAMPAT-MCS (GenBank ID AY436765)
  • Vector type
    Plant Expression ; binary expression vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    basic leucine zipper transcriptional regulator 63
  • Alt name
    bZIP63
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    450
  • Mutation
    deleted amino acids 1-165
  • GenBank ID
    NC_003076.8
  • Entrez Gene
    BZO2H3 (a.k.a. AT5G28770, Arabidopsis thaliana basic leucine zipper 63, AtbZIP63, T32B20.4, T32B20_4)
  • Promoter Promoter 35SS
  • Tag / Fusion Protein
    • 3xHA-tag (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTTCATTTCATTTGGAGAGGAC
  • 3′ sequencing primer GCTCAACACATGAGCGAAACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    "CYCLOPS, a DNA-binding transcriptional activator, orchestrates symbiotic root nodule development." Singh et al. 2014; A. Binder

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAMPATPro35SS:3xHA-At bZIP63CC was a gift from Martin Parniske (Addgene plasmid # 97284)
Related items: