pGEX-SF3B1-NTerm
(Plasmid
#97425)
-
PurposeExpresses human SF3B1 (AA 1-500) with N-term GST tag for inducible expression in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX 6P2
-
Backbone manufacturerGE Healthcare Life Sciences
- Backbone size w/o insert (bp) 4985
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow protocol provided in GE Healthcare pGEX-6P-2 GST Expression Vector Product Specification Sheet for inducible expression of GST-N-term-SF3B1 and refer to associated handbook on GST Gene fusion system Use a strain such as BL21 for protein expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSF3B1-N-term (AA1-500)
-
SpeciesSynthetic
-
Insert Size (bp)1500
-
MutationSilent mutation at nt876, aa289 (AGG to AGA)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer CGCGGATCCATGGCTAAGATCGCTAAAACCCACGAGGAC
- 3′ sequencing primer CCGGAATTCTCACAGCTTCATGATTTTGCGCTCCTTCTGTTCCTCTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-SF3B1-NTerm was a gift from Alex Minella (Addgene plasmid # 97425 ; http://n2t.net/addgene:97425 ; RRID:Addgene_97425) -
For your References section:
Cyclin-dependent kinase 1 (CDK1) and CDK2 have opposing roles in regulating interactions of splicing factor 3B1 with chromatin. Murthy T, Bluemn T, Gupta A, Reimer M, Rao S, Pillai MM, Minella AC. J Biol Chem. 2018 May 15. pii: RA118.001654. doi: 10.1074/jbc.RA118.001654. 10.1074/jbc.RA118.001654 PubMed 29764937