Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGEX-SF3B1-NTerm
(Plasmid #97425)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 97425 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX 6P2
  • Backbone manufacturer
    GE Healthcare Life Sciences
  • Backbone size w/o insert (bp) 4985
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Follow protocol provided in GE Healthcare pGEX-6P-2 GST Expression Vector Product Specification Sheet for inducible expression of GST-N-term-SF3B1 and refer to associated handbook on GST Gene fusion system Use a strain such as BL21 for protein expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SF3B1-N-term (AA1-500)
  • Species
    Synthetic
  • Insert Size (bp)
    1500
  • Mutation
    Silent mutation at nt876, aa289 (AGG to AGA)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer CGCGGATCCATGGCTAAGATCGCTAAAACCCACGAGGAC
  • 3′ sequencing primer CCGGAATTCTCACAGCTTCATGATTTTGCGCTCCTTCTGTTCCTCTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-SF3B1-NTerm was a gift from Alex Minella (Addgene plasmid # 97425 ; http://n2t.net/addgene:97425 ; RRID:Addgene_97425)
  • For your References section:

    Cyclin-dependent kinase 1 (CDK1) and CDK2 have opposing roles in regulating interactions of splicing factor 3B1 with chromatin. Murthy T, Bluemn T, Gupta A, Reimer M, Rao S, Pillai MM, Minella AC. J Biol Chem. 2018 May 15. pii: RA118.001654. doi: 10.1074/jbc.RA118.001654. 10.1074/jbc.RA118.001654 PubMed 29764937