pJ414-PCY1:H695A
(Plasmid
#98155)
-
PurposeExpresses PCY1H695A from Saponaria vaccaria possesing a N-terminal His6-tag (TEV cleavable) in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJ414
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions200 rpm
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePeptide cyclase 1:H695A
-
Alt namePCY1:H695A
-
SpeciesSaponaria vaccaria
-
Insert Size (bp)2175
-
MutationChanged histidine 695 to alanine
- Promoter T7
-
Tag
/ Fusion Protein
- His6-TEV (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGGCTGATTAAATACTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJ414-PCY1:H695A was a gift from James Naismith (Addgene plasmid # 98155 ; http://n2t.net/addgene:98155 ; RRID:Addgene_98155) -
For your References section:
Characterization of the Fast and Promiscuous Macrocyclase from Plant PCY1 Enables the Use of Simple Substrates. Ludewig H, Czekster CM, Oueis E, Munday ES, Arshad M, Synowsky SA, Bent AF, Naismith JH. ACS Chem Biol. 2018 Mar 16;13(3):801-811. doi: 10.1021/acschembio.8b00050. Epub 2018 Feb 12. 10.1021/acschembio.8b00050 PubMed 29377663