-
PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBa-eGFP
- Backbone size w/o insert (bp) 6755
- Total vector size (bp) 9335
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLDLR
-
Alt namehuman low density lipoprotein receptor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3326
-
Mutationnone
-
GenBank IDNM_000527
-
Entrez GeneLDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
- Promoter Chicken Beta Actin
-
Tags
/ Fusion Proteins
- GFP (N terminal on insert)
- LDLR signal sequence, N-term of GFP so GFP remains on mature protein when ss is cleaved (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII-vector, NheI-insert (destroyed during cloning)
- 3′ cloning site RsrII (not destroyed)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa-LSS-GFP-LDLR wt was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 98184 ; http://n2t.net/addgene:98184 ; RRID:Addgene_98184) -
For your References section:
A novel split kinesin assay identifies motor proteins that interact with distinct vesicle populations. Jenkins B, Decker H, Bentley M, Luisi J, Banker G. J Cell Biol. 2012 Aug 20;198(4):749-61. doi: 10.1083/jcb.201205070. 10.1083/jcb.201205070 PubMed 22908316