Skip to main content

DHL708
(Bacterial strain #98417)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 98417 Bacteria in agar stab 1 $89

Backbone

  • Vector backbone
    none

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DHL708
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Genotype: MC4100 ∆clpPX

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).

The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.

Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DHL708 was a gift from Johan Paulsson (Addgene plasmid # 98417)
  • For your References section:

    Synchronous long-term oscillations in a synthetic gene circuit. Potvin-Trottier L, Lord ND, Vinnicombe G, Paulsson J. Nature. 2016 Oct 12;538(7626):514-517. doi: 10.1038/nature19841. 10.1038/nature19841 PubMed 27732583