Skip to main content
Addgene

pRSETa-mEos4b-V69T
(Plasmid #98572)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98572 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRsetA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEos4b-V69T
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 term (GCTAGTTATTGCTCAGCGG)
  • 3′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pRSETa_ mEos4b (Plasmid #51073)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mEos4b-V69T is named and aligned in reference to the Dendra2 fluorescent protein sequence. The mutation in the mEos4b reference is at position 70. However, to avoid confusion, we named this protein in alignment with Dendra2 (see Fig. S1a, 10.1002/anie.201702870).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSETa-mEos4b-V69T was a gift from Ulrike Endesfelder (Addgene plasmid # 98572 ; http://n2t.net/addgene:98572 ; RRID:Addgene_98572)
  • For your References section:

    A general mechanism of photoconversion of green-to-red fluorescent proteins based on blue and infrared light reduces phototoxicity in live-cell single-molecule imaging. Turkowyd B, Balinovic A, Virant D, Golz Carnero HG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. Angew Chem Int Ed Engl. 2017 Jun 2. doi: 10.1002/anie.201702870. 10.1002/anie.201702870 PubMed 28574633