pRSETa-mMaple3-V157I
(Plasmid #98577)

• Purpose: photoconvertible fluorescent protein mMaple3-V157I in pRSetA plasmid, photoconvertible by primed conversion mechanism, bacterial overexpression, sequence is codon optimised for E. coli
• Depositing Lab: Ulrike Endesfelder
• Publication: Turkowyd et al Angew Chem Int Ed Engl. 2017 Jun 2. doi: 10.1002/anie.201702870.

Backbone

• Vector backbone: pRsetA
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mMaple3-V157I
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: T7 term (GCTAGTTATTGCTCAGCGG)
• 3′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: 10.1073/pnas.1406593111 in different backbone

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mMaple3-V157I is named and aligned in reference to the Dendra2 fluorescent protein sequence. The mutation in the mMaple3 reference is at position 166. However, to avoid confusion, we named this protein in alignment with Dendra2 (see Fig. S1a, 10.1002/anie.201702870).