Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #98578)


Item Catalog # Description Quantity Price (USD)
Plasmid 98578 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 term (GCTAGTTATTGCTCAGCGG)
  • 3′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pRSETb-pcDronpa2 (Plasmid #78184)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSETb-pcDronpa2-A69T was a gift from Ulrike Endesfelder (Addgene plasmid # 98578 ; ; RRID:Addgene_98578)
  • For your References section:

    A general mechanism of photoconversion of green-to-red fluorescent proteins based on blue and infrared light reduces phototoxicity in live-cell single-molecule imaging. Turkowyd B, Balinovic A, Virant D, Golz Carnero HG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. Angew Chem Int Ed Engl. 2017 Jun 2. doi: 10.1002/anie.201702870. 10.1002/anie.201702870 PubMed 28574633
Commonly requested with: