nucHCB2
(Plasmid
#98581)
-
PurposeNuclear Huntingtin Chromobody 2: "iVHH4" intrabody recognizing amino acids 49–148 of huntingtin, fused to eYFP and nuclear localization signal.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepeYFPN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5116
-
Modifications to backboneBears the peYFPC1 multiple cloning site
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHCB2
-
Alt nameiVHH4
-
SpeciesSynthetic
-
Insert Size (bp)386
- Promoter CMV
-
Tags
/ Fusion Proteins
- YFP (C terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTACGGTGGGAGGTC
- 3′ sequencing primer GTAAAACCTCTACAAATGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySCHUT, M. H., PEPERS, B. A., KLOOSTER, R., VAN DER MAAREL, S. M., EL KHATABI, M., VERRIPS, T., DEN DUNNEN, J. T., VAN OMMEN, G. J. & VAN ROON-MOM, W. M. 2015. Selection and characterization of llama single domain antibodies against N-terminal huntingtin. Neurol Sci, 36, 429-34.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nucHCB2 was a gift from Ray Truant (Addgene plasmid # 98581 ; http://n2t.net/addgene:98581 ; RRID:Addgene_98581) -
For your References section:
Huntingtin is a scaffolding protein in the ATM oxidative DNA damage response complex. Maiuri T, Mocle AJ, Hung CL, Xia J, van Roon-Mom WM, Truant R. Hum Mol Genet. 2016 Dec 25. pii: ddw395. doi: 10.1093/hmg/ddw395. 10.1093/hmg/ddw395 PubMed 28017939