pCML 314
(Plasmid
#98584)
-
PurposepCsrA-NYFP + CsrB-2MS2BD. Expresses protein-NYFP and RNA-2MS2BD fusions in E. coli for TriFC assay (ampR).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneDerived from pDMSA-Y1 (Kostecki et al., 2010, 10.1371/journal.pone.0009225)
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMay need to be grown at room temperature for complementation assay.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCsrA
-
SpeciesEscherichia Coli K-12 MG1655
-
Insert Size (bp)183
-
GenBank ID
- Promoter pLacO
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer CCGTTTACGTCGCCGTCCAGCTCGACCAGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecsrB
-
SpeciesEscherichia coli K-12 MG1655
-
Insert Size (bp)330
- Promoter pLacO
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer CCTTAGGATCCATATATAGGGCCC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCML 314 was a gift from Lydia Contreras (Addgene plasmid # 98584 ; http://n2t.net/addgene:98584 ; RRID:Addgene_98584) -
For your References section:
Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria. Gelderman G, Sivakumar A, Lipp S, Contreras L. Biotechnol Bioeng. 2015 Feb;112(2):365-75. doi: 10.1002/bit.25351. Epub 2014 Sep 26. 10.1002/bit.25351 PubMed 25080893