Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRL_yEGFP_hc
(Plasmid #98746)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98746 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pL0A_2-3
  • Backbone size w/o insert (bp) 4703
  • Total vector size (bp) 5929
  • Modifications to backbone
    Insertion of new homology regions A2 and A3
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Yeast-enhanced green fluorescent protein
  • Alt name
    yEGFP
  • Insert Size (bp)
    717
  • Promoter synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATTAGGTCCTTTGTAGC
  • 3′ sequencing primer GGGACCTAGACTTCAGGTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRL_yEGFP_hc was a gift from Bernd Müller-Röber (Addgene plasmid # 98746 ; http://n2t.net/addgene:98746 ; RRID:Addgene_98746)
  • For your References section:

    PhiReX: a programmable and red light-regulated protein expression switch for yeast. Hochrein L, Machens F, Messerschmidt K, Mueller-Roeber B. Nucleic Acids Res. 2017 Sep 6;45(15):9193-9205. doi: 10.1093/nar/gkx610. 10.1093/nar/gkx610 PubMed 28911120