Skip to main content

pCML 961
(Plasmid #98848)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98848 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Derived from pCML 314
  • Backbone size w/o insert (bp) 4200
  • Total vector size (bp) 4550
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    5' UTR + first 100 nucleotides of coding sequence of the aidB gene
  • Species
    Escherichia coli K-12 MG1655
  • Insert Size (bp)
    128
  • Promoter pLacO

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    csrA
  • Species
    Escherichia coli K-12 MG1655
  • Insert Size (bp)
    183
  • Promoter pLacO

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer N/A
  • 3′ sequencing primer CCGTTTACGTCGCCGTCCAGCTCGACCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note- A 3bp deletion in CsrB_Terminator (bps 1423-25 in Genbank file) was found in Addgene's quality control sequence result. The depositing lab has noted this deletion does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCML 961 was a gift from Lydia Contreras (Addgene plasmid # 98848 ; http://n2t.net/addgene:98848 ; RRID:Addgene_98848)
  • For your References section:

    Integrative FourD omics approach profiles the target network of the carbon storage regulatory system. Sowa SW, Gelderman G, Leistra AN, Buvanendiran A, Lipp S, Pitaktong A, Vakulskas CA, Romeo T, Baldea M, Contreras LM. Nucleic Acids Res. 2017 Feb 28;45(4):1673-1686. doi: 10.1093/nar/gkx048. 10.1093/nar/gkx048 PubMed 28126921