pCML 961
(Plasmid
#98848)
-
PurposepTriFC_aidB. Expresses protein-NYFP and 2MS2BD-5' UTR mStrawberry fusions in E. coli for Dual-fluorescence TriFC assay (ampR).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98848 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneDerived from pCML 314
- Backbone size w/o insert (bp) 4200
- Total vector size (bp) 4550
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name5' UTR + first 100 nucleotides of coding sequence of the aidB gene
-
SpeciesEscherichia coli K-12 MG1655
-
Insert Size (bp)128
- Promoter pLacO
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer GGGTTCATTAGATCTGCGCGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecsrA
-
SpeciesEscherichia coli K-12 MG1655
-
Insert Size (bp)183
- Promoter pLacO
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer CCGTTTACGTCGCCGTCCAGCTCGACCAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note- A 3bp deletion in CsrB_Terminator (bps 1423-25 in Genbank file) was found in Addgene's quality control sequence result. The depositing lab has noted this deletion does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCML 961 was a gift from Lydia Contreras (Addgene plasmid # 98848 ; http://n2t.net/addgene:98848 ; RRID:Addgene_98848) -
For your References section:
Integrative FourD omics approach profiles the target network of the carbon storage regulatory system. Sowa SW, Gelderman G, Leistra AN, Buvanendiran A, Lipp S, Pitaktong A, Vakulskas CA, Romeo T, Baldea M, Contreras LM. Nucleic Acids Res. 2017 Feb 28;45(4):1673-1686. doi: 10.1093/nar/gkx048. 10.1093/nar/gkx048 PubMed 28126921