Skip to main content

pN-iRS3GG
(Plasmid #98858)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98858 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCML 521
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Escherichia coli str. K-12 substr. MG1655 is recommended by the depositor for expression
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PheS cassette to be selectively replaced by unique asRNA probes
  • Insert Size (bp)
    1087
  • Promoter pBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (not destroyed)
  • 3′ cloning site BsmbI (not destroyed)
  • 5′ sequencing primer CCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that a 6bp deletion was found during Addgene's quality control which eliminates the XhoI site (CTCGAG). The depositing lab noted there are additional sites present for cloning, and disruption of XhoI does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN-iRS3GG was a gift from Lydia Contreras (Addgene plasmid # 98858 ; http://n2t.net/addgene:98858 ; RRID:Addgene_98858)
  • For your References section:

    Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions. Vazquez-Anderson J, Mihailovic MK, Baldridge KC, Reyes KG, Haning K, Cho SH, Amador P, Powell WB, Contreras LM. Nucleic Acids Res. 2017 May 19;45(9):5523-5538. doi: 10.1093/nar/gkx115. 10.1093/nar/gkx115 PubMed 28334800
Commonly requested with: