Skip to main content

pARiBo1
(Plasmid #98892)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98892 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTZ19R
  • Backbone manufacturer
    Fisher Scientific
  • Backbone size w/o insert (bp) 2790
  • Total vector size (bp) 2959
  • Modifications to backbone
    The T7 promotor was removed from the pTZ19R vector backbone but included in the vector insert.
  • Vector type
    in vitro transcription vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARiBo1
  • Species
    Synthetic
  • Insert Size (bp)
    169
  • Promoter T7 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCACACAGGAAACAGCTATGACCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pARiBo1 was a gift from Pascale Legault (Addgene plasmid # 98892 ; http://n2t.net/addgene:98892 ; RRID:Addgene_98892)
  • For your References section:

    The ARiBo tag: a reliable tool for affinity purification of RNAs under native conditions. Di Tomasso G, Lampron P, Dagenais P, Omichinski JG, Legault P. Nucleic Acids Res. 2011 Feb;39(3):e18. doi: 10.1093/nar/gkq1084. Epub 2010 Nov 11. 10.1093/nar/gkq1084 PubMed 21071425