pARiBo1
(Plasmid
#98892)
-
PurposeExpresses ARiBo-fused RNA in vitro with T7 RNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTZ19R
-
Backbone manufacturerFisher Scientific
- Backbone size w/o insert (bp) 2790
- Total vector size (bp) 2959
-
Modifications to backboneThe T7 promotor was removed from the pTZ19R vector backbone but included in the vector insert.
-
Vector typein vitro transcription vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARiBo1
-
SpeciesSynthetic
-
Insert Size (bp)169
- Promoter T7 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCACACAGGAAACAGCTATGACCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pARiBo1 was a gift from Pascale Legault (Addgene plasmid # 98892 ; http://n2t.net/addgene:98892 ; RRID:Addgene_98892) -
For your References section:
The ARiBo tag: a reliable tool for affinity purification of RNAs under native conditions. Di Tomasso G, Lampron P, Dagenais P, Omichinski JG, Legault P. Nucleic Acids Res. 2011 Feb;39(3):e18. doi: 10.1093/nar/gkq1084. Epub 2010 Nov 11. 10.1093/nar/gkq1084 PubMed 21071425