pZa-tetO-csgAWY-CmR
(Plasmid
#98939)
-
PurposeConductive Curli Protein csgAWY
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98939 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZa-tetO-CmR
- Backbone size w/o insert (bp) 2274
- Total vector size (bp) 2763
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecsgAWY
-
Insert Size (bp)489
-
GenBank IDNC_000913.3
- Promoter tetO
-
Tag
/ Fusion Protein
- YYRKYKEWDDY (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TGGTGAAAGTTGGAACCTCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZa-tetO-csgAWY-CmR was a gift from Urartu Seker (Addgene plasmid # 98939 ; http://n2t.net/addgene:98939 ; RRID:Addgene_98939) -
For your References section:
Genetically encoded conductive protein nanofibers secreted by engineered cells. Kalyoncu E, Ahan RE, Ölmez TT, Şeker UÖŞ. RSC Adv. 2017, Issue 52. doi: 10.1039/C7RA06289C 10.1039/C7RA06289C