pLXIN2-EGFP
(Plasmid
#99204)
-
PurposeEGFP expressing bicistronic retroviral vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLXIN2
-
Backbone manufacturerMathupala, S.P.
- Backbone size w/o insert (bp) 6059
- Total vector size (bp) 6780
-
Modifications to backboneEGFP (enhanced green fluorecent protein) cDNA was inserted between EcoRI and XhoI sites of the MCS in vector.
-
Vector typeMammalian Expression, Retroviral ; Bicistronic retroviral expression vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan be propagated in E. coli DH5alpha if necessary. However, for maintenance it is best to propagate in recombination deficient strains such as SURE or STBL.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameenhanced green fluorescent protein
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)721
-
MutationA Kozak sequence was inserted 5' to ATG to enhance translation efficiency. EGFP was PCR amplified off EGFP-N1 vector (GenBank #U55762).
-
GenBank IDU55762 U55762
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GTGCAATCCATCTTGTTCAATGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.
Please note the Kozak sequence is missing a nucleotide; however, this has no functional consequence for expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXIN2-EGFP was a gift from Saroj Mathupala (Addgene plasmid # 99204 ; http://n2t.net/addgene:99204 ; RRID:Addgene_99204)