Skip to main content

pLXIN2-EGFP
(Plasmid #99204)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99204 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLXIN2
  • Backbone manufacturer
    Mathupala, S.P.
  • Backbone size w/o insert (bp) 6059
  • Total vector size (bp) 6780
  • Modifications to backbone
    EGFP (enhanced green fluorecent protein) cDNA was inserted between EcoRI and XhoI sites of the MCS in vector.
  • Vector type
    Mammalian Expression, Retroviral ; Bicistronic retroviral expression vector
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can be propagated in E. coli DH5alpha if necessary. However, for maintenance it is best to propagate in recombination deficient strains such as SURE or STBL.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Alt name
    enhanced green fluorescent protein
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    721
  • Mutation
    A Kozak sequence was inserted 5' to ATG to enhance translation efficiency. EGFP was PCR amplified off EGFP-N1 vector (GenBank #U55762).
  • GenBank ID
    U55762 U55762

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GTGCAATCCATCTTGTTCAATGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.

Please note the Kozak sequence is missing a nucleotide; however, this has no functional consequence for expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXIN2-EGFP was a gift from Saroj Mathupala (Addgene plasmid # 99204 ; http://n2t.net/addgene:99204 ; RRID:Addgene_99204)
Commonly requested with: