Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLXRN
(Plasmid #99206)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99206 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLXSN
  • Backbone manufacturer
    Dr. Dusty Miller, Fred Hutchinson Cancer Center, Seattle, WA
  • Modifications to backbone
    The SV40 promoter driving Neomycin selection marker was replaced with an internal ribosome entry site/sequence (IRES) from encephalomyocarditis virus to generate the bicistronic retroviral vector
  • Vector type
    Mammalian Expression, Retroviral
  • Promoter LTR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    can be propagated in E. coli DH5alpha. However, above strains are recommended to minimize recombination events.
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GTAAAGCATGTGCACCGAGGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Neomycin marker is already in the parental vector pLXSN

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When transfected into packaging cell lines PE501 (ecotropic) or PA317 (amphotropic) the vector will generate live retrovirus. Thus, under these conditions BSL2 level safety will be required.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXRN was a gift from Peter Pedersen (Addgene plasmid # 99206 ; http://n2t.net/addgene:99206 ; RRID:Addgene_99206)